Transcript: Human XM_005257818.4

PREDICTED: Homo sapiens RecQ like helicase 5 (RECQL5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RECQL5 (9400)
Length:
3789
CDS:
174..3212

Additional Resources:

NCBI RefSeq record:
XM_005257818.4
NBCI Gene record:
RECQL5 (9400)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257818.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236026 TTGTCGCCCATTGGAATATTG pLKO_005 1162 CDS 100% 13.200 18.480 N RECQL5 n/a
2 TRCN0000051415 CCCTAAAGGTACGAGTAAGTT pLKO.1 448 CDS 100% 5.625 7.875 N RECQL5 n/a
3 TRCN0000236028 TGCGACCATGGCTGTAGTAAA pLKO_005 281 CDS 100% 13.200 9.240 N RECQL5 n/a
4 TRCN0000236025 CTGTAATTGTTGCAACCATTA pLKO_005 1105 CDS 100% 10.800 7.560 N RECQL5 n/a
5 TRCN0000236027 GTACGCTGAAGAAGGTCTTTG pLKO_005 226 CDS 100% 10.800 7.560 N RECQL5 n/a
6 TRCN0000051417 GCCACTATCATGGCCTTTGAT pLKO.1 1353 CDS 100% 5.625 3.938 N RECQL5 n/a
7 TRCN0000051414 CGTCTCTATTACTCCAGGAAT pLKO.1 1251 CDS 100% 4.950 3.465 N RECQL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257818.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.