Transcript: Human XM_005258339.3

PREDICTED: Homo sapiens TATA-box binding protein associated factor 4b (TAF4B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAF4B (6875)
Length:
2902
CDS:
444..2321

Additional Resources:

NCBI RefSeq record:
XM_005258339.3
NBCI Gene record:
TAF4B (6875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258339.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053150 GCCGAACTCTAGCTCACAATT pLKO.1 929 CDS 100% 13.200 18.480 N TAF4B n/a
2 TRCN0000290896 GCCGAACTCTAGCTCACAATT pLKO_005 929 CDS 100% 13.200 18.480 N TAF4B n/a
3 TRCN0000296690 CCGAGACCACAAGTAACATAA pLKO_005 856 CDS 100% 13.200 9.240 N TAF4B n/a
4 TRCN0000053151 GCAGAAGAATTTACTAGGAAA pLKO.1 1341 CDS 100% 4.950 3.465 N TAF4B n/a
5 TRCN0000290827 GCAGAAGAATTTACTAGGAAA pLKO_005 1341 CDS 100% 4.950 3.465 N TAF4B n/a
6 TRCN0000053148 GCCCAATCTTAAAGCAGAGAA pLKO.1 1151 CDS 100% 4.950 3.465 N TAF4B n/a
7 TRCN0000290825 GCCCAATCTTAAAGCAGAGAA pLKO_005 1151 CDS 100% 4.950 3.465 N TAF4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258339.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.