Transcript: Human XM_005258675.2

PREDICTED: Homo sapiens capicua transcriptional repressor (CIC), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CIC (23152)
Length:
5555
CDS:
133..4950

Additional Resources:

NCBI RefSeq record:
XM_005258675.2
NBCI Gene record:
CIC (23152)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329970 AGAAGATGCCAGGACTTATAG pLKO_005 4961 3UTR 100% 13.200 9.240 N CIC n/a
2 TRCN0000329971 GAGACCATGGCCAGCAAATTC pLKO_005 3913 CDS 100% 13.200 9.240 N CIC n/a
3 TRCN0000018922 AGATTGGAAGTGGTGCAACAA pLKO.1 927 CDS 100% 4.950 3.465 N CIC n/a
4 TRCN0000018920 CTTAGTGTATTCGGACAAGAA pLKO.1 2310 CDS 100% 4.950 3.465 N CIC n/a
5 TRCN0000329967 CTTAGTGTATTCGGACAAGAA pLKO_005 2310 CDS 100% 4.950 3.465 N CIC n/a
6 TRCN0000018924 CCTGGGCTCTTACCGCAAGAA pLKO.1 4281 CDS 100% 1.650 1.155 N CIC n/a
7 TRCN0000329969 CCTGGGCTCTTACCGCAAGAA pLKO_005 4281 CDS 100% 1.650 1.155 N CIC n/a
8 TRCN0000018923 GTAGCCTTTGGCAAAGGCTAT pLKO.1 1696 CDS 100% 0.405 0.284 N CIC n/a
9 TRCN0000018921 CTTTGCTGAGTTGCCTGAGTT pLKO.1 4197 CDS 100% 4.950 2.970 N CIC n/a
10 TRCN0000329968 CTTTGCTGAGTTGCCTGAGTT pLKO_005 4197 CDS 100% 4.950 2.970 N CIC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.