Transcript: Human XM_005258833.4

PREDICTED: Homo sapiens BRD4 interacting chromatin remodeling complex associated protein (BICRA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BICRA (29998)
Length:
5782
CDS:
238..4920

Additional Resources:

NCBI RefSeq record:
XM_005258833.4
NBCI Gene record:
BICRA (29998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258833.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038095 GATGGTAATGATCGACCGAAT pLKO.1 3750 CDS 100% 4.050 5.670 N BICRA n/a
2 TRCN0000430857 TTCTTGCATGGATCCGAGAAG pLKO_005 301 CDS 100% 4.050 5.670 N BICRA n/a
3 TRCN0000038094 CCCAGGCCATGCTCAATAAAT pLKO.1 3680 CDS 100% 15.000 10.500 N BICRA n/a
4 TRCN0000429243 ACAAAGTGGACGAGGAGTTTG pLKO_005 3629 CDS 100% 10.800 7.560 N BICRA n/a
5 TRCN0000446915 CATCGGGCTCAAGCTCAAGAT pLKO_005 4152 CDS 100% 4.950 3.465 N BICRA n/a
6 TRCN0000038096 CGGAATCATCCTCCAGAACAA pLKO.1 3141 CDS 100% 4.950 3.465 N BICRA n/a
7 TRCN0000038097 GACCTAGACTTCCTGGAAGAT pLKO.1 454 CDS 100% 4.950 3.465 N BICRA n/a
8 TRCN0000038098 CCTGGCGTCTAGCCCGGAGAA pLKO.1 2244 CDS 100% 0.000 0.000 N BICRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258833.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.