Transcript: Human XM_005259838.4

PREDICTED: Homo sapiens MAU2 sister chromatid cohesion factor (MAU2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAU2 (23383)
Length:
3998
CDS:
137..2011

Additional Resources:

NCBI RefSeq record:
XM_005259838.4
NBCI Gene record:
MAU2 (23383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259838.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239287 TACAACGAGGCCAAGCGATTT pLKO_005 1592 CDS 100% 10.800 8.640 N MAU2 n/a
2 TRCN0000139296 CCACAGGGAGAGTAACAACAT pLKO.1 1711 CDS 100% 4.950 3.465 N MAU2 n/a
3 TRCN0000145128 GAAACTCTGAAGATGTCCAAT pLKO.1 1619 CDS 100% 4.950 3.465 N MAU2 n/a
4 TRCN0000122688 GAGCTTCCAAGTCCTGGGAAT pLKO.1 2119 3UTR 100% 4.050 2.835 N MAU2 n/a
5 TRCN0000140523 GCGAGTGTGTATATACGGGAA pLKO.1 1436 CDS 100% 2.160 1.512 N MAU2 n/a
6 TRCN0000239288 CACTGCTGAGAGACCTGAATA pLKO_005 1797 CDS 100% 13.200 7.920 N MAU2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259838.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11732 pDONR223 100% 34.9% 34.9% None 1_1215del;1339_1341delGTA n/a
2 ccsbBroad304_11732 pLX_304 0% 34.9% 34.9% V5 1_1215del;1339_1341delGTA n/a
Download CSV