Transcript: Human XM_005259912.4

PREDICTED: Homo sapiens LYL1 basic helix-loop-helix family member (LYL1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LYL1 (4066)
Length:
4094
CDS:
1321..1941

Additional Resources:

NCBI RefSeq record:
XM_005259912.4
NBCI Gene record:
LYL1 (4066)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259912.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436401 TCCTCAACAGTGTCTACATTG pLKO_005 1424 CDS 100% 10.800 7.560 N Lyl1 n/a
2 TRCN0000017542 AGATGGAGCAAACCGCTTTGA pLKO.1 1904 CDS 100% 4.950 3.465 N LYL1 n/a
3 TRCN0000017539 CTTCCTCAACAGTGTCTACAT pLKO.1 1422 CDS 100% 4.950 3.465 N LYL1 n/a
4 TRCN0000429914 GAAGGACCAGTGAAGACGTCA pLKO_005 2051 3UTR 100% 2.640 1.848 N LYL1 n/a
5 TRCN0000017540 AGCCATGAAGTACATCGGCTT pLKO.1 1680 CDS 100% 2.160 1.512 N LYL1 n/a
6 TRCN0000416388 CACTTTGGCCCTGCACTACCA pLKO_005 1392 CDS 100% 0.880 0.616 N LYL1 n/a
7 TRCN0000017538 CGTCAAGGAAAGGGCAGTGGA pLKO.1 1995 3UTR 100% 0.880 0.616 N LYL1 n/a
8 TRCN0000017541 GCCGGTTGAAGCGGAGACCAA pLKO.1 1478 CDS 100% 0.000 0.000 N LYL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259912.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.