Transcript: Human XM_005260000.2

PREDICTED: Homo sapiens dedicator of cytokinesis 6 (DOCK6), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOCK6 (57572)
Length:
6605
CDS:
62..6403

Additional Resources:

NCBI RefSeq record:
XM_005260000.2
NBCI Gene record:
DOCK6 (57572)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418085 TGTCGCTCAAGTTCGAGATTG pLKO_005 858 CDS 100% 10.800 15.120 N DOCK6 n/a
2 TRCN0000122966 GCTGCTTCATATCAAGCCCTA pLKO.1 1603 CDS 100% 2.160 1.728 N DOCK6 n/a
3 TRCN0000416195 AGTCCAGCTGCAGTGAATTTA pLKO_005 1836 CDS 100% 15.000 10.500 N DOCK6 n/a
4 TRCN0000122965 GCCTACATCCAGATCACGTAT pLKO.1 5711 CDS 100% 4.950 3.465 N DOCK6 n/a
5 TRCN0000122968 CCTGATGTTCAACCTGCACAT pLKO.1 4918 CDS 100% 4.050 2.835 N DOCK6 n/a
6 TRCN0000122967 CCTGGTCATCAAGTTGGAGAA pLKO.1 1072 CDS 100% 4.050 2.835 N DOCK6 n/a
7 TRCN0000122307 CCAAAGCTGTACCTAGAGGAA pLKO.1 6415 3UTR 100% 2.640 1.848 N DOCK6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.