Transcript: Human XM_005261204.5

PREDICTED: Homo sapiens minichromosome maintenance complex component 3 associated protein (MCM3AP), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCM3AP (8888)
Length:
6658
CDS:
581..6523

Additional Resources:

NCBI RefSeq record:
XM_005261204.5
NBCI Gene record:
MCM3AP (8888)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261204.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330178 GAGATCCCTGATACCATTAAT pLKO_005 5186 CDS 100% 15.000 21.000 N MCM3AP n/a
2 TRCN0000353590 GTGTCTAGGCGAACGACTAAA pLKO_005 6412 CDS 100% 13.200 18.480 N MCM3AP n/a
3 TRCN0000147895 GCATAAAGACATGGCTATCTT pLKO.1 2062 CDS 100% 5.625 7.875 N MCM3AP n/a
4 TRCN0000146606 CAGGAGCATTTACGGATTTAA pLKO.1 6252 CDS 100% 15.000 12.000 N MCM3AP n/a
5 TRCN0000147338 GAAACTCATCTGAGGTGAAAT pLKO.1 3075 CDS 100% 13.200 9.240 N MCM3AP n/a
6 TRCN0000330104 GAAACTCATCTGAGGTGAAAT pLKO_005 3075 CDS 100% 13.200 9.240 N MCM3AP n/a
7 TRCN0000330179 CTAAGCCGCCATTTCGATTTG pLKO_005 660 CDS 100% 10.800 7.560 N MCM3AP n/a
8 TRCN0000180875 GCCCACTTAGTGGACTTGTTT pLKO.1 4220 CDS 100% 5.625 3.938 N MCM3AP n/a
9 TRCN0000183014 CGTCTTCTAGTAATGTAGGAA pLKO.1 630 CDS 100% 3.000 2.100 N MCM3AP n/a
10 TRCN0000330101 CGTCTTCTAGTAATGTAGGAA pLKO_005 630 CDS 100% 3.000 2.100 N MCM3AP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261204.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.