Transcript: Human XM_005261417.3

PREDICTED: Homo sapiens calcineurin binding protein 1 (CABIN1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CABIN1 (23523)
Length:
7533
CDS:
424..7101

Additional Resources:

NCBI RefSeq record:
XM_005261417.3
NBCI Gene record:
CABIN1 (23523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005261417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413663 TGACCACGATTACGTCAAATG pLKO_005 4488 CDS 100% 10.800 15.120 N CABIN1 n/a
2 TRCN0000141395 CTGCGATTCTATGTGCGAGTA pLKO.1 3160 CDS 100% 4.050 5.670 N CABIN1 n/a
3 TRCN0000142076 CCGCCACAACTATTATCACCT pLKO.1 6353 CDS 100% 2.640 3.696 N CABIN1 n/a
4 TRCN0000438328 TGAAGGTGGATTGGTCGCCAT pLKO_005 7323 3UTR 100% 2.160 1.728 N CABIN1 n/a
5 TRCN0000419654 CCTCCTGGCTGATTATCATTT pLKO_005 3600 CDS 100% 13.200 9.240 N CABIN1 n/a
6 TRCN0000124153 CGAGAGGAACAAGACCAATTT pLKO.1 5142 CDS 100% 13.200 9.240 N Cabin1 n/a
7 TRCN0000433139 GGAGTTTGTGGTCCGTGTTTA pLKO_005 2256 CDS 100% 13.200 9.240 N CABIN1 n/a
8 TRCN0000427927 GCGAGAGGAACAAGACCAATT pLKO_005 5141 CDS 100% 10.800 7.560 N CABIN1 n/a
9 TRCN0000143405 CCAGCACTATAAGAGTCTCTA pLKO.1 4995 CDS 100% 4.950 3.465 N CABIN1 n/a
10 TRCN0000145431 GCACTGTTCATGTTTGAGTAT pLKO.1 3355 CDS 100% 4.950 3.465 N CABIN1 n/a
11 TRCN0000141275 CCGAGAGAACTTCTTTCCTGT pLKO.1 6240 CDS 100% 2.640 1.848 N CABIN1 n/a
12 TRCN0000122571 CCTCATGGCATCCTCCCTGTA pLKO.1 7240 3UTR 100% 1.350 0.945 N CABIN1 n/a
13 TRCN0000143332 GAGGAGGAAGATGATTCCTTT pLKO.1 1705 CDS 100% 0.495 0.297 N CABIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005261417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.