Transcript: Human XM_005262129.5

PREDICTED: Homo sapiens solute carrier family 25 member 53 (SLC25A53), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A53 (401612)
Length:
5648
CDS:
711..1634

Additional Resources:

NCBI RefSeq record:
XM_005262129.5
NBCI Gene record:
SLC25A53 (401612)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262129.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130582 CTGATTGTGCTGGTTGCTAAT pLKO.1 1404 CDS 100% 10.800 15.120 N SLC25A53 n/a
2 TRCN0000148132 GCTAATATGCAGTCCCATATT pLKO.1 1419 CDS 100% 1.320 1.848 N SLC25A53 n/a
3 TRCN0000147804 GCCATCCTTTAGCATCTATAA pLKO.1 1727 3UTR 100% 13.200 9.240 N SLC25A53 n/a
4 TRCN0000265528 TGGTGTCTGGTAGTGTCAATG pLKO_005 1354 CDS 100% 10.800 7.560 N Slc25a53 n/a
5 TRCN0000127841 GCCGTTTCCAACTTTATGTCT pLKO.1 813 CDS 100% 3.000 2.100 N SLC25A53 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3073 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3073 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262129.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.