Transcript: Human XM_005262220.2

PREDICTED: Homo sapiens insulin receptor substrate 4 (IRS4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IRS4 (8471)
Length:
6581
CDS:
241..4011

Additional Resources:

NCBI RefSeq record:
XM_005262220.2
NBCI Gene record:
IRS4 (8471)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063614 CCATTCGCTATGATGCTGAAA pLKO.1 3344 CDS 100% 4.950 6.930 N IRS4 n/a
2 TRCN0000063617 CTCGGCTGGAATACTACGAAA pLKO.1 560 CDS 100% 4.950 6.930 N IRS4 n/a
3 TRCN0000422482 GTTCTGGCTCTGGCAACTTTG pLKO_005 1625 CDS 100% 10.800 7.560 N IRS4 n/a
4 TRCN0000426586 TAAGAGACCTAACCGACTTTC pLKO_005 2898 CDS 100% 10.800 7.560 N IRS4 n/a
5 TRCN0000063615 GCCAATGTTACCTGGAAAGTT pLKO.1 2727 CDS 100% 5.625 3.938 N IRS4 n/a
6 TRCN0000063616 GCTGGTTTCAACCTGTTGCTA pLKO.1 3722 CDS 100% 3.000 2.100 N IRS4 n/a
7 TRCN0000063613 CCTGATACTAATAAAGAGGAT pLKO.1 2524 CDS 100% 2.640 1.848 N IRS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.