Transcript: Human XM_005262397.4

PREDICTED: Homo sapiens coagulation factor IX (F9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
F9 (2158)
Length:
2690
CDS:
46..1302

Additional Resources:

NCBI RefSeq record:
XM_005262397.4
NBCI Gene record:
F9 (2158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262397.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372160 GCGAAATGTGATTCGAATTAT pLKO_005 795 CDS 100% 15.000 21.000 N F9 n/a
2 TRCN0000006784 CCGGTATGTCAACTGGATTAA pLKO.1 1260 CDS 100% 13.200 18.480 N F9 n/a
3 TRCN0000006785 CTGTGTTGAAACTGGTGTTAA pLKO.1 717 CDS 100% 13.200 10.560 N F9 n/a
4 TRCN0000372158 GCAGTTGCAAGGATGACATTA pLKO_005 362 CDS 100% 13.200 9.240 N F9 n/a
5 TRCN0000372215 GACGAACCCTTAGTGCTAAAC pLKO_005 880 CDS 100% 10.800 7.560 N F9 n/a
6 TRCN0000006783 CCAAGGTTAATTCATTGGAAT pLKO.1 1317 3UTR 100% 4.950 3.465 N F9 n/a
7 TRCN0000006786 CCACAACTACAATGCAGCTAT pLKO.1 822 CDS 100% 4.950 3.465 N F9 n/a
8 TRCN0000006787 CTATGAATGTTGGTGTCCCTT pLKO.1 387 CDS 100% 2.640 1.848 N F9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262397.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00531 pDONR223 100% 90.6% 90.6% None 389_390ins129 n/a
2 ccsbBroad304_00531 pLX_304 0% 90.6% 90.6% V5 389_390ins129 n/a
Download CSV