Transcript: Human XM_005262621.3

PREDICTED: Homo sapiens syndecan 1 (SDC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SDC1 (6382)
Length:
2924
CDS:
38..955

Additional Resources:

NCBI RefSeq record:
XM_005262621.3
NBCI Gene record:
SDC1 (6382)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262621.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072578 CCGACTGCTTTGGACCTAAAT pLKO.1 1283 3UTR 100% 13.200 18.480 N SDC1 n/a
2 TRCN0000426614 GTTTCTCGCATAGGACCTTTC pLKO_005 1167 3UTR 100% 6.000 8.400 N SDC1 n/a
3 TRCN0000072582 GCAAGATATCACCTTGTCACA pLKO.1 178 CDS 100% 2.640 2.112 N SDC1 n/a
4 TRCN0000072580 GAGCAGGACTTCACCTTTGAA pLKO.1 644 CDS 100% 5.625 3.938 N SDC1 n/a
5 TRCN0000421256 ACTCGGTTTCTCCAAACTGAA pLKO_005 1222 3UTR 100% 4.950 3.465 N SDC1 n/a
6 TRCN0000414046 ACGCAGCTCCTGACGGCTATT pLKO_005 224 CDS 100% 3.600 2.520 N SDC1 n/a
7 TRCN0000072581 CATGCTGTACCGCATGAAGAA pLKO.1 841 CDS 100% 0.495 0.297 N SDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262621.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06924 pDONR223 100% 95.6% 92.9% None (many diffs) n/a
2 ccsbBroad304_06924 pLX_304 0% 95.6% 92.9% V5 (many diffs) n/a
3 TRCN0000471313 CGTATGATAGTATAATGACGGAAT pLX_317 40.7% 95.6% 92.9% V5 (many diffs) n/a
Download CSV