Transcript: Human XM_005263218.4

PREDICTED: Homo sapiens centromere protein U (CENPU), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CENPU (79682)
Length:
2559
CDS:
16..1362

Additional Resources:

NCBI RefSeq record:
XM_005263218.4
NBCI Gene record:
CENPU (79682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263218.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425402 AGGCGATTTCTCCTGAATTTA pLKO_005 1681 3UTR 100% 15.000 21.000 N CENPU n/a
2 TRCN0000431421 AGCTCAAGAACCAAACGTAAA pLKO_005 1221 CDS 100% 10.800 15.120 N CENPU n/a
3 TRCN0000072644 GCGAAATATCAACCATCAGTT pLKO.1 1317 CDS 100% 4.950 6.930 N CENPU n/a
4 TRCN0000072646 CCTTTACATAGCACAGCTATA pLKO.1 325 CDS 100% 10.800 8.640 N CENPU n/a
5 TRCN0000072647 GCATTGAAGAAAGTGATACAA pLKO.1 527 CDS 100% 5.625 4.500 N CENPU n/a
6 TRCN0000072643 CCCAGGTATGAGCTATAATAA pLKO.1 1614 3UTR 100% 15.000 10.500 N CENPU n/a
7 TRCN0000412966 ACATCAAGGAGTTGAATATTG pLKO_005 845 CDS 100% 13.200 9.240 N CENPU n/a
8 TRCN0000434961 AGACGTTCAAAGAACACTTTA pLKO_005 157 CDS 100% 13.200 9.240 N CENPU n/a
9 TRCN0000072645 CCCTTAGGAATGCAGCATATT pLKO.1 1154 CDS 100% 13.200 9.240 N CENPU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263218.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04107 pDONR223 100% 92.7% 91% None (many diffs) n/a
2 ccsbBroadEn_12594 pDONR223 100% 39.2% 39.2% None 1_816del n/a
3 ccsbBroad304_12594 pLX_304 0% 39.2% 39.2% V5 1_816del n/a
Download CSV