Transcript: Human XM_005263319.3

PREDICTED: Homo sapiens FH2 domain containing 1 (FHDC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FHDC1 (85462)
Length:
6596
CDS:
217..3648

Additional Resources:

NCBI RefSeq record:
XM_005263319.3
NBCI Gene record:
FHDC1 (85462)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116245 GCCAAACTATTCACTTCGGAT pLKO.1 960 CDS 100% 2.640 3.696 N FHDC1 n/a
2 TRCN0000437606 CCATTGGCTCTGGGAATTAAG pLKO_005 2209 CDS 100% 13.200 9.240 N FHDC1 n/a
3 TRCN0000116243 CGGTCCATTGTAGAAGATATT pLKO.1 784 CDS 100% 13.200 9.240 N FHDC1 n/a
4 TRCN0000415641 GTTCAGAAGACTGCTAGATTA pLKO_005 1300 CDS 100% 13.200 9.240 N FHDC1 n/a
5 TRCN0000432374 CACTACCAAATTGATACAAAG pLKO_005 592 CDS 100% 10.800 7.560 N FHDC1 n/a
6 TRCN0000116242 CCCTGGTAGAATGCTGGATTT pLKO.1 5010 3UTR 100% 10.800 7.560 N FHDC1 n/a
7 TRCN0000116244 CGGAGCATGAACATTGGGATA pLKO.1 736 CDS 100% 4.050 2.835 N FHDC1 n/a
8 TRCN0000116246 GCCATGGTGCTAAAGAAGGAA pLKO.1 985 CDS 100% 3.000 1.800 N FHDC1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4635 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4635 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.