Transcript: Human XM_005263373.3

PREDICTED: Homo sapiens LPS responsive beige-like anchor protein (LRBA), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRBA (987)
Length:
10288
CDS:
475..9081

Additional Resources:

NCBI RefSeq record:
XM_005263373.3
NBCI Gene record:
LRBA (987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148506 CCACGATGGAAACAGATGATA pLKO.1 8810 CDS 100% 5.625 4.500 N LRBA n/a
2 TRCN0000343926 CCACGATGGAAACAGATGATA pLKO_005 8810 CDS 100% 5.625 4.500 N LRBA n/a
3 TRCN0000148544 CCTCAGTTCCAACAGTTGATT pLKO.1 5807 CDS 100% 5.625 3.938 N LRBA n/a
4 TRCN0000343862 CCTCAGTTCCAACAGTTGATT pLKO_005 5807 CDS 100% 5.625 3.938 N LRBA n/a
5 TRCN0000150073 CGATGGAAGAATAGTGAACTT pLKO.1 1402 CDS 100% 4.950 3.465 N LRBA n/a
6 TRCN0000343861 CGATGGAAGAATAGTGAACTT pLKO_005 1402 CDS 100% 4.950 3.465 N LRBA n/a
7 TRCN0000148136 GCAGAAGATATTCACAGACAT pLKO.1 6196 CDS 100% 4.950 3.465 N LRBA n/a
8 TRCN0000343863 GCAGAAGATATTCACAGACAT pLKO_005 6196 CDS 100% 4.950 3.465 N LRBA n/a
9 TRCN0000147756 GTCATCTTCATAGCACAACAA pLKO.1 9741 3UTR 100% 4.950 3.465 N LRBA n/a
10 TRCN0000148424 CTGTGCTTCTTCAGCACTAAT pLKO.1 9517 3UTR 100% 1.320 0.924 N LRBA n/a
11 TRCN0000343927 CTGTGCTTCTTCAGCACTAAT pLKO_005 9517 3UTR 100% 1.320 0.924 N LRBA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.