Transcript: Human XM_005263479.3

PREDICTED: Homo sapiens castor zinc finger 1 (CASZ1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASZ1 (54897)
Length:
5490
CDS:
139..5490

Additional Resources:

NCBI RefSeq record:
XM_005263479.3
NBCI Gene record:
CASZ1 (54897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263479.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438189 TGCCTTGACCCTGAGTGTAAC pLKO_005 1684 CDS 100% 10.800 15.120 N CASZ1 n/a
2 TRCN0000130988 CGGCTGCACATTCACTTTCAA pLKO.1 2055 CDS 100% 5.625 7.875 N CASZ1 n/a
3 TRCN0000437790 ACGTGATGACCCACGAGAACT pLKO_005 1910 CDS 100% 4.950 6.930 N CASZ1 n/a
4 TRCN0000446419 GAACGGGAGCACCTACAAGAA pLKO_005 1194 CDS 100% 4.950 6.930 N CASZ1 n/a
5 TRCN0000131216 GTCCCGGCAAATTCATCTCTT pLKO.1 3049 CDS 100% 4.950 6.930 N CASZ1 n/a
6 TRCN0000129561 GACTTCTCTAGAGAACGCCAA pLKO.1 3648 CDS 100% 2.160 3.024 N CASZ1 n/a
7 TRCN0000129821 CGTCACTGAAGATGTAAACAT pLKO.1 1578 CDS 100% 5.625 3.938 N CASZ1 n/a
8 TRCN0000129755 CTCTAAGTATGAGGAGTACAT pLKO.1 918 CDS 100% 4.950 3.465 N CASZ1 n/a
9 TRCN0000125160 CGACTGCAAGTACAAGCTCAA pLKO.1 4890 CDS 100% 4.050 2.835 N Casz1 n/a
10 TRCN0000131029 CGAGTACCTGAAGTCAACCTT pLKO.1 1485 CDS 100% 3.000 2.100 N CASZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263479.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.