Transcript: Human XM_005263688.3

PREDICTED: Homo sapiens Rho guanine nucleotide exchange factor 4 (ARHGEF4), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF4 (50649)
Length:
7138
CDS:
362..1813

Additional Resources:

NCBI RefSeq record:
XM_005263688.3
NBCI Gene record:
ARHGEF4 (50649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263688.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418019 CGCGACGTGTTGTACTACAAG pLKO_005 1352 CDS 100% 4.950 6.930 N ARHGEF4 n/a
2 TRCN0000415548 GCGTACCATCTTCGGGAACAT pLKO_005 718 CDS 100% 4.950 6.930 N ARHGEF4 n/a
3 TRCN0000047562 CCAGCTCATCTACTGTAAGAA pLKO.1 1318 CDS 100% 5.625 3.938 N ARHGEF4 n/a
4 TRCN0000047560 CCTCCATGTGAGCATCAAGAA pLKO.1 1432 CDS 100% 4.950 3.465 N ARHGEF4 n/a
5 TRCN0000421841 GACTTGAGAACATCGACAAGA pLKO_005 1152 CDS 100% 4.950 3.465 N ARHGEF4 n/a
6 TRCN0000421224 GACCAACGTCATCAACGAGAT pLKO_005 595 CDS 100% 4.050 2.835 N ARHGEF4 n/a
7 TRCN0000047559 GCTCAGCAAGTACGTGTACTT pLKO.1 922 CDS 100% 0.495 0.347 N ARHGEF4 n/a
8 TRCN0000047558 GCAGCGAATGTTCTTTCTCTT pLKO.1 1291 CDS 100% 4.950 2.970 N ARHGEF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263688.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.