Transcript: Human XM_005264433.4

PREDICTED: Homo sapiens cytochrome P450 family 26 subfamily B member 1 (CYP26B1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYP26B1 (56603)
Length:
4520
CDS:
167..1531

Additional Resources:

NCBI RefSeq record:
XM_005264433.4
NBCI Gene record:
CYP26B1 (56603)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264433.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064054 CGAGCTTGATGGTTTCCAGAT pLKO.1 1129 CDS 100% 4.050 5.670 N CYP26B1 n/a
2 TRCN0000430859 GCCTCAGCGTCAAGTTCTTTG pLKO_005 1446 CDS 100% 10.800 7.560 N CYP26B1 n/a
3 TRCN0000423927 AGGTCTTCTCCAAGATCTTCA pLKO_005 420 CDS 100% 4.950 3.465 N CYP26B1 n/a
4 TRCN0000064056 CTTTGAGGTCTACCAGCAGTT pLKO.1 622 CDS 100% 4.050 2.835 N CYP26B1 n/a
5 TRCN0000064057 GAGCTGATCTTTGCGGCCTAT pLKO.1 866 CDS 100% 4.050 2.835 N CYP26B1 n/a
6 TRCN0000064053 GCAACGTGTTCAAGACGCATT pLKO.1 234 CDS 100% 4.050 2.835 N CYP26B1 n/a
7 TRCN0000064055 GTCCAATTCCATTGGCGACAT pLKO.1 382 CDS 100% 4.050 2.835 N CYP26B1 n/a
8 TRCN0000413471 TCAAAGACGTGAACGTGTTCG pLKO_005 1209 CDS 100% 4.050 2.835 N CYP26B1 n/a
9 TRCN0000173771 CAATTCCATTGGCGACATCCA pLKO.1 385 CDS 100% 2.640 1.848 N Cyp26b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264433.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03727 pDONR223 100% 87.3% 87.3% None (many diffs) n/a
2 ccsbBroad304_03727 pLX_304 0% 87.3% 87.3% V5 (many diffs) n/a
Download CSV