Transcript: Human XM_005264453.4

PREDICTED: Homo sapiens baculoviral IAP repeat containing 6 (BIRC6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BIRC6 (57448)
Length:
15564
CDS:
1..14586

Additional Resources:

NCBI RefSeq record:
XM_005264453.4
NBCI Gene record:
BIRC6 (57448)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264453.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369112 ATTGGATGGTTACGGTTATTA pLKO_005 9994 CDS 100% 15.000 21.000 N BIRC6 n/a
2 TRCN0000369113 TGGTAGTGGCAACTGATATAA pLKO_005 5504 CDS 100% 15.000 21.000 N BIRC6 n/a
3 TRCN0000364501 CCCGTCAGTAGTGCGGTAAAT pLKO_005 13009 CDS 100% 13.200 18.480 N BIRC6 n/a
4 TRCN0000364500 GGACGTTACGGGAGTACAAAT pLKO_005 5596 CDS 100% 13.200 18.480 N BIRC6 n/a
5 TRCN0000004158 GCGTTCTTTCTACAGTGCATT pLKO.1 11305 CDS 100% 4.950 6.930 N BIRC6 n/a
6 TRCN0000364502 CCGCCTCACCAGTCCATTATT pLKO_005 5329 CDS 100% 15.000 12.000 N BIRC6 n/a
7 TRCN0000369114 TGGATAAATCACTGCTATATA pLKO_005 14840 3UTR 100% 15.000 10.500 N BIRC6 n/a
8 TRCN0000004159 GCTGTAGTGAATGGTGCAAAT pLKO.1 2365 CDS 100% 10.800 7.560 N BIRC6 n/a
9 TRCN0000004157 CCATGCTATATCCAGAAGTAA pLKO.1 12275 CDS 100% 5.625 3.938 N BIRC6 n/a
10 TRCN0000004160 CGGCTATGAAACCCAAACCTT pLKO.1 13544 CDS 100% 3.000 2.100 N BIRC6 n/a
11 TRCN0000004161 GCTCATTTGTTGGTTTCAGAT pLKO.1 8257 CDS 100% 4.950 2.970 N BIRC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264453.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.