Transcript: Human XM_005264862.4

PREDICTED: Homo sapiens family with sequence similarity 3 member D (FAM3D), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM3D (131177)
Length:
1281
CDS:
271..945

Additional Resources:

NCBI RefSeq record:
XM_005264862.4
NBCI Gene record:
FAM3D (131177)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159205 GATGTTTATTCGAAGCTACAT pLKO.1 330 CDS 100% 4.950 6.930 N FAM3D n/a
2 TRCN0000166066 GTGCTTTGAAGACCGCATGAT pLKO.1 516 CDS 100% 4.950 6.930 N FAM3D n/a
3 TRCN0000166232 CCAGCCAACTACTTTGCGTTT pLKO.1 454 CDS 100% 4.050 5.670 N FAM3D n/a
4 TRCN0000158456 CACCTAGTGAAATTCCTTAAA pLKO.1 652 CDS 100% 13.200 9.240 N FAM3D n/a
5 TRCN0000372225 CATGTACTCTGGAGATGTTAT pLKO_005 630 CDS 100% 13.200 9.240 N FAM3D n/a
6 TRCN0000372226 CAATGTGGGCAGAGGCCTAAA pLKO_005 555 CDS 100% 10.800 7.560 N FAM3D n/a
7 TRCN0000164003 CAGGAAACTCTTCTCTGACTT pLKO.1 744 CDS 100% 4.950 3.465 N FAM3D n/a
8 TRCN0000372169 CCTCATCTTTGCCATAGTCAC pLKO_005 303 CDS 100% 4.050 2.835 N FAM3D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04871 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04871 pLX_304 0% 100% 100% V5 n/a
Download CSV