Transcript: Human XM_005266305.3

PREDICTED: Homo sapiens zinc finger CCCH-type containing 13 (ZC3H13), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZC3H13 (23091)
Length:
8137
CDS:
386..5479

Additional Resources:

NCBI RefSeq record:
XM_005266305.3
NBCI Gene record:
ZC3H13 (23091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005266305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274371 CATCGAAAGGAGGATACATAT pLKO_005 1931 CDS 100% 13.200 18.480 N ZC3H13 n/a
2 TRCN0000018240 GCCACAGAACACGAGTAGAAA pLKO.1 3948 CDS 100% 5.625 7.875 N ZC3H13 n/a
3 TRCN0000018241 CCCTCCTATACCAGAAGATAT pLKO.1 1186 CDS 100% 13.200 9.240 N ZC3H13 n/a
4 TRCN0000274309 GAAAGTTCTCGTACGGAAATA pLKO_005 1994 CDS 100% 13.200 9.240 N ZC3H13 n/a
5 TRCN0000175152 GATTCTGACAATGGAGATATT pLKO.1 833 CDS 100% 13.200 9.240 N Zc3h13 n/a
6 TRCN0000274368 TTGATAGTCACAGTAGTAATA pLKO_005 2133 CDS 100% 13.200 9.240 N ZC3H13 n/a
7 TRCN0000018239 CCAAGTTAGATGATGCACATT pLKO.1 4806 CDS 100% 4.950 3.465 N ZC3H13 n/a
8 TRCN0000018242 CCTCACAATCAGGATCATCTA pLKO.1 1389 CDS 100% 4.950 3.465 N ZC3H13 n/a
9 TRCN0000274306 CCTCACAATCAGGATCATCTA pLKO_005 1389 CDS 100% 4.950 3.465 N ZC3H13 n/a
10 TRCN0000018238 CCTCTCCTTATCCTTCACATT pLKO.1 1497 CDS 100% 4.950 3.465 N ZC3H13 n/a
11 TRCN0000176014 GAATCTTCAAGAGGGAGACAT pLKO.1 728 CDS 100% 4.950 3.465 N Zc3h13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005266305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.