Transcript: Human XM_005267971.1

PREDICTED: Homo sapiens chromosome 14 open reading frame 93 (C14orf93), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C14orf93 (60686)
Length:
2311
CDS:
383..1999

Additional Resources:

NCBI RefSeq record:
XM_005267971.1
NBCI Gene record:
C14orf93 (60686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077920 CGGGATCTTGTACTCTCTAAA pLKO.1 1283 CDS 100% 13.200 9.240 N C14orf93 n/a
2 TRCN0000077918 GCAGAACACTGGTGGGATAAA pLKO.1 2147 3UTR 100% 13.200 9.240 N C14orf93 n/a
3 TRCN0000419187 CCAATGACAAGAGATTCAATG pLKO_005 1332 CDS 100% 10.800 7.560 N 4931414P19Rik n/a
4 TRCN0000077921 CCAGAACTTTACAATCCTAAT pLKO.1 1850 CDS 100% 10.800 7.560 N C14orf93 n/a
5 TRCN0000190215 CCACCTGGATGCTAACTCTAA pLKO.1 1753 CDS 100% 4.950 3.465 N 4931414P19Rik n/a
6 TRCN0000077922 CCTTACTAAGAGGCGTGAGTA pLKO.1 1486 CDS 100% 4.950 3.465 N C14orf93 n/a
7 TRCN0000222746 CGCCTGTAAGAGTGAGACTAA pLKO.1 448 CDS 100% 4.950 3.465 N C14orf93 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14240 pDONR223 100% 92.4% 92.1% None 1181G>T;1310_1429del;1614A>T n/a
2 ccsbBroad304_14240 pLX_304 0% 92.4% 92.1% V5 1181G>T;1310_1429del;1614A>T n/a
Download CSV