Transcript: Human XM_005267989.4

PREDICTED: Homo sapiens SEL1L adaptor subunit of ERAD E3 ubiquitin ligase (SEL1L), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEL1L (6400)
Length:
5649
CDS:
109..2424

Additional Resources:

NCBI RefSeq record:
XM_005267989.4
NBCI Gene record:
SEL1L (6400)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267989.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161665 GCAGTACATACGGGAAACAAA pLKO.1 2193 CDS 100% 5.625 7.875 N SEL1L n/a
2 TRCN0000160837 GACTGGGCATTAAACAGGATA pLKO.1 2069 CDS 100% 4.950 6.930 N SEL1L n/a
3 TRCN0000161385 GCAAGCATTGTAGGTGAGAAT pLKO.1 1843 CDS 100% 4.950 6.930 N SEL1L n/a
4 TRCN0000160811 CCTCTGGACTTGGTGTTAATT pLKO.1 905 CDS 100% 15.000 10.500 N SEL1L n/a
5 TRCN0000165954 GCCTCTGGACTTGGTGTTAAT pLKO.1 904 CDS 100% 13.200 9.240 N SEL1L n/a
6 TRCN0000160439 CCCAGATAATTGCTTCCAAAT pLKO.1 4069 3UTR 100% 10.800 7.560 N SEL1L n/a
7 TRCN0000159940 GCTATGTTTAATCTGGGATAT pLKO.1 2035 CDS 100% 10.800 7.560 N SEL1L n/a
8 TRCN0000165668 GCAGAGTAGTTGCTGGTCAAA pLKO.1 263 CDS 100% 4.950 3.465 N SEL1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267989.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.