Transcript: Human XM_005268027.5

PREDICTED: Homo sapiens telomerase associated protein 1 (TEP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TEP1 (7011)
Length:
10833
CDS:
180..8063

Additional Resources:

NCBI RefSeq record:
XM_005268027.5
NBCI Gene record:
TEP1 (7011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268027.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231544 TTGCCCTTTCCTTCGAATATA pLKO_005 1932 CDS 100% 15.000 21.000 N TEP1 n/a
2 TRCN0000231543 GTACTGCCATGACGGACAAAT pLKO_005 1264 CDS 100% 13.200 18.480 N TEP1 n/a
3 TRCN0000221584 CCGATGATACACTCTTTCTTA pLKO.1 5362 CDS 100% 5.625 7.875 N TEP1 n/a
4 TRCN0000039829 CGACGATATTTCTGTGCCATT pLKO.1 1146 CDS 100% 4.050 5.670 N TEP1 n/a
5 TRCN0000009840 TAATCCTTACTAGAACCACAA pLKO.1 8295 3UTR 100% 4.050 5.670 N TEP1 n/a
6 TRCN0000231546 ATCCTAGTAGGACCCTAATAT pLKO_005 7555 CDS 100% 15.000 10.500 N TEP1 n/a
7 TRCN0000231547 GATGTGCCACTCGGGAATAAT pLKO_005 8065 3UTR 100% 15.000 10.500 N TEP1 n/a
8 TRCN0000231545 CTATCTGCGTGGCCAACTAAA pLKO_005 3839 CDS 100% 13.200 9.240 N TEP1 n/a
9 TRCN0000010359 TAGTGATGCCAGCATGGATAG pLKO.1 7775 CDS 100% 6.000 4.200 N TEP1 n/a
10 TRCN0000221586 CCTGGAAATCTGACTTTGTTT pLKO.1 3301 CDS 100% 5.625 3.938 N TEP1 n/a
11 TRCN0000221585 GCCAAAGCAGATTTGAAGTTA pLKO.1 7341 CDS 100% 5.625 3.938 N TEP1 n/a
12 TRCN0000018330 CAGATATCCTCTCCTTGAAGA pLKO.1 304 CDS 100% 4.950 3.465 N TEP1 n/a
13 TRCN0000221583 GCCTGTGTTCTCATGTGGATT pLKO.1 8206 3UTR 100% 4.950 2.970 N TEP1 n/a
14 TRCN0000127601 CGCTTGTAATCCCAGCACTTT pLKO.1 8611 3UTR 100% 4.950 2.475 Y CCDC30 n/a
15 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 8666 3UTR 100% 4.050 2.025 Y INTS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268027.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.