Transcript: Human XM_005268303.4

PREDICTED: Homo sapiens ATPase phospholipid transporting 11A (ATP11A), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP11A (23250)
Length:
3878
CDS:
384..3803

Additional Resources:

NCBI RefSeq record:
XM_005268303.4
NBCI Gene record:
ATP11A (23250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268303.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051886 GACGTTTGGAACGCTGGTATT pLKO.1 3389 CDS 100% 10.800 15.120 N ATP11A n/a
2 TRCN0000419937 TATGCAGGACTACGGTTTAAT pLKO_005 2639 CDS 100% 15.000 12.000 N ATP11A n/a
3 TRCN0000416899 AGGAGCAGATTCTTCGATATT pLKO_005 2111 CDS 100% 13.200 9.240 N ATP11A n/a
4 TRCN0000051885 GCTGCTGTTCTACGTTGTCTT pLKO.1 3497 CDS 100% 4.950 3.465 N ATP11A n/a
5 TRCN0000051884 CCAGAGGATGTACTACGTGTT pLKO.1 3560 CDS 100% 4.050 2.835 N ATP11A n/a
6 TRCN0000101531 CGAGTGATAGAAGGCAAAGTA pLKO.1 2136 CDS 100% 5.625 7.875 N Atp11a n/a
7 TRCN0000051887 GCAACAGAGAGAGTCCAGAAT pLKO.1 3693 CDS 100% 4.950 6.930 N ATP11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268303.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.