Transcript: Human XM_005268802.3

PREDICTED: Homo sapiens otogelin like (OTOGL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OTOGL (283310)
Length:
8745
CDS:
757..7842

Additional Resources:

NCBI RefSeq record:
XM_005268802.3
NBCI Gene record:
OTOGL (283310)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147298 GCAGGGAAATATAGCATCATT pLKO.1 8645 3UTR 100% 5.625 7.875 N OTOGL n/a
2 TRCN0000148411 CCTGTTCCACTATGTCATGAT pLKO.1 6820 CDS 100% 4.950 3.465 N OTOGL n/a
3 TRCN0000183245 GCCCTATAAATGTTGCATCTT pLKO.1 7637 CDS 100% 4.950 3.465 N OTOGL n/a
4 TRCN0000149380 GCTGTGTGACTCGTACAAATT pLKO.1 8401 3UTR 100% 13.200 7.920 N OTOGL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13497 pDONR223 100% 9.4% 9.4% None 1_6411del;6480G>A n/a
2 ccsbBroad304_13497 pLX_304 0% 9.4% 9.4% V5 1_6411del;6480G>A n/a
Download CSV