Transcript: Human XM_005269499.1

PREDICTED: Homo sapiens phosphoinositide-3-kinase adaptor protein 1 (PIK3AP1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIK3AP1 (118788)
Length:
4358
CDS:
210..2093

Additional Resources:

NCBI RefSeq record:
XM_005269499.1
NBCI Gene record:
PIK3AP1 (118788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033295 CCTGACAACGAACCATACATT pLKO.1 1317 CDS 100% 5.625 7.875 N PIK3AP1 n/a
2 TRCN0000196557 GTCGAGTATATATGACCCTTT pLKO.1 1445 CDS 100% 4.050 5.670 N PIK3AP1 n/a
3 TRCN0000195494 CGAGGATAATGAAGTCCCTGA pLKO.1 1913 CDS 100% 2.160 1.728 N PIK3AP1 n/a
4 TRCN0000195077 CCATTCTCATTGCTGATAATG pLKO.1 2202 3UTR 100% 13.200 9.240 N PIK3AP1 n/a
5 TRCN0000195351 CCTTTCCACAGACCTGCTTAT pLKO.1 947 CDS 100% 10.800 7.560 N PIK3AP1 n/a
6 TRCN0000033294 GCCACTGAAGACCTCTATGTT pLKO.1 1035 CDS 100% 5.625 3.938 N PIK3AP1 n/a
7 TRCN0000033297 CTGAGGATTCTCCCTCTGTAA pLKO.1 316 CDS 100% 4.950 3.465 N PIK3AP1 n/a
8 TRCN0000033296 GCTAACCGAATCCCTGAAGAA pLKO.1 575 CDS 100% 4.950 3.465 N PIK3AP1 n/a
9 TRCN0000033298 GCTTATGAAATGCTCGCTCAA pLKO.1 962 CDS 100% 4.050 2.835 N PIK3AP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13070 pDONR223 100% 61.6% 55.5% None (many diffs) n/a
2 ccsbBroad304_13070 pLX_304 0% 61.6% 55.5% V5 (many diffs) n/a
Download CSV