Transcript: Human XM_005269541.5

PREDICTED: Homo sapiens sterile alpha motif domain containing 8 (SAMD8), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAMD8 (142891)
Length:
6293
CDS:
94..1341

Additional Resources:

NCBI RefSeq record:
XM_005269541.5
NBCI Gene record:
SAMD8 (142891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269541.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232589 ATCCACCACTCCCAGATATAT pLKO_005 641 CDS 100% 15.000 21.000 N SAMD8 n/a
2 TRCN0000257351 CATCTTTCATTATGGTTATAG pLKO_005 590 CDS 100% 13.200 18.480 N SAMD8 n/a
3 TRCN0000232590 CTTTGCCATGACGGAAGTATG pLKO_005 693 CDS 100% 10.800 15.120 N SAMD8 n/a
4 TRCN0000152540 GTGGCATGATTCTGTGCTATA pLKO.1 713 CDS 100% 10.800 15.120 N SAMD8 n/a
5 TRCN0000257972 GTTAATGGCACAGTACCTAAT pLKO_005 1267 CDS 100% 10.800 8.640 N Samd8 n/a
6 TRCN0000150691 GAGAAATTACATCGAGCCTTT pLKO.1 904 CDS 100% 4.050 3.240 N SAMD8 n/a
7 TRCN0000232592 TGGCTGCCCATGAACATTATT pLKO_005 1109 CDS 100% 15.000 10.500 N SAMD8 n/a
8 TRCN0000154068 CGTTCACACATGTGGAGATTA pLKO.1 960 CDS 100% 13.200 9.240 N SAMD8 n/a
9 TRCN0000152031 CCTCTGGAAATCAAAGTCTTA pLKO.1 259 CDS 100% 4.950 3.465 N SAMD8 n/a
10 TRCN0000153138 GCTGGAATTTCTTGCACACTT pLKO.1 1049 CDS 100% 4.950 3.465 N SAMD8 n/a
11 TRCN0000152571 GTAGTCTGATGGGAACTGTAT pLKO.1 791 CDS 100% 4.950 3.465 N SAMD8 n/a
12 TRCN0000151707 CCTCTTTGGAATCTTCTTCAT pLKO.1 1086 CDS 100% 4.950 2.970 N SAMD8 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3415 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3416 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269541.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.