Transcript: Human XM_005270269.4

PREDICTED: Homo sapiens neuralized E3 ubiquitin protein ligase 1 (NEURL1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEURL1 (9148)
Length:
3978
CDS:
131..1804

Additional Resources:

NCBI RefSeq record:
XM_005270269.4
NBCI Gene record:
NEURL1 (9148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270269.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221073 CTCGGCTGTTATGCTGTTCTT pLKO.1 631 CDS 100% 4.950 6.930 N NEURL1 n/a
2 TRCN0000221075 CGATGAGTGCACCATTTGCTA pLKO.1 1633 CDS 100% 3.000 4.200 N NEURL1 n/a
3 TRCN0000221077 GTTTGCCAATGAGGGCAACAT pLKO.1 559 CDS 100% 0.495 0.693 N NEURL1 n/a
4 TRCN0000416509 TGCATGCTGAGGGCTAAATTG pLKO_005 2071 3UTR 100% 13.200 9.240 N NEURL1 n/a
5 TRCN0000423199 AGTGCAGCATGGAGTGGATTT pLKO_005 2237 3UTR 100% 10.800 7.560 N NEURL1 n/a
6 TRCN0000415765 CTCAGCCTGCCCTAATCTTTC pLKO_005 2096 3UTR 100% 10.800 7.560 N NEURL1 n/a
7 TRCN0000416227 TCGCATTCTGGGTGGACAAGA pLKO_005 582 CDS 100% 4.950 3.465 N NEURL1 n/a
8 TRCN0000221076 CCGGTCCTCATCTACGAGCAA pLKO.1 374 CDS 100% 0.880 0.616 N NEURL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270269.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.