Transcript: Human XM_005270465.3

PREDICTED: Homo sapiens Kruppel like factor 17 (KLF17), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLF17 (128209)
Length:
1940
CDS:
13..852

Additional Resources:

NCBI RefSeq record:
XM_005270465.3
NBCI Gene record:
KLF17 (128209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270465.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107673 CCACAGGCCAACAACAACAAT pLKO.1 796 CDS 100% 5.625 3.938 N KLF17 n/a
2 TRCN0000107674 CCATCTTGAACATGTCTTCAT pLKO.1 194 CDS 100% 4.950 3.465 N KLF17 n/a
3 TRCN0000107670 GCAGTCTTCAAGTTCTACATT pLKO.1 918 3UTR 100% 5.625 3.375 N KLF17 n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1883 3UTR 100% 4.950 2.475 Y ERAP2 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1884 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270465.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.