Transcript: Human XM_005272478.3

PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein M (HNRNPM), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HNRNPM (4670)
Length:
2464
CDS:
57..2204

Additional Resources:

NCBI RefSeq record:
XM_005272478.3
NBCI Gene record:
HNRNPM (4670)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123826 CCACCCAGTATCCTAAATAAT pLKO.1 594 CDS 100% 15.000 21.000 N Hnrnpm n/a
2 TRCN0000350395 CGAATTGATAGAAACGCTTAA pLKO_005 2184 CDS 100% 10.800 15.120 N HNRNPM n/a
3 TRCN0000001246 CTGTGCAAGCTATATCTATGT pLKO.1 826 CDS 100% 4.950 6.930 N HNRNPM n/a
4 TRCN0000314949 CTGTGCAAGCTATATCTATGT pLKO_005 826 CDS 100% 4.950 6.930 N HNRNPM n/a
5 TRCN0000001244 ACAAGCATAGTCTGAGCGGAA pLKO.1 454 CDS 100% 2.160 1.728 N HNRNPM n/a
6 TRCN0000314685 ACAAGCATAGTCTGAGCGGAA pLKO_005 454 CDS 100% 2.160 1.728 N HNRNPM n/a
7 TRCN0000001243 AGAGCCTTCATTACAAACATA pLKO.1 270 CDS 100% 5.625 3.938 N HNRNPM n/a
8 TRCN0000314754 AGAGCCTTCATTACAAACATA pLKO_005 270 CDS 100% 5.625 3.938 N HNRNPM n/a
9 TRCN0000123824 GCTGGATGTATAAAGATGTTT pLKO.1 2280 3UTR 100% 5.625 3.938 N Hnrnpm n/a
10 TRCN0000351872 GCTGGATGTATAAAGATGTTT pLKO_005 2280 3UTR 100% 5.625 3.938 N Hnrnpm n/a
11 TRCN0000001247 GATGGCTACGACTGGTGGGAT pLKO.1 536 CDS 100% 0.880 0.616 N HNRNPM n/a
12 TRCN0000001245 GAGAGGAGAGATCATTGCAAA pLKO.1 1154 CDS 100% 4.950 2.970 N HNRNPM n/a
13 TRCN0000348710 CAATCGCTTTGAGCCATATTC pLKO_005 230 CDS 100% 13.200 9.240 N Hnrnpm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272478.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.