Transcript: Human XM_005272622.4

PREDICTED: Homo sapiens OTU deubiquitinase 5 (OTUD5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OTUD5 (55593)
Length:
5885
CDS:
3214..4917

Additional Resources:

NCBI RefSeq record:
XM_005272622.4
NBCI Gene record:
OTUD5 (55593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272622.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233198 CATCGGAATATCCACTATAAT pLKO_005 4186 CDS 100% 15.000 21.000 N OTUD5 n/a
2 TRCN0000141847 GCATGCTGAATTGGGCATGAA pLKO.1 4599 CDS 100% 0.495 0.396 N OTUD5 n/a
3 TRCN0000233197 AGGACTTTACCACCTACATTA pLKO_005 4004 CDS 100% 13.200 9.240 N OTUD5 n/a
4 TRCN0000233195 ACAACAGTGAGGACGAGTATG pLKO_005 3737 CDS 100% 10.800 7.560 N OTUD5 n/a
5 TRCN0000233199 AGAACGTCTGAGCCTTCAATG pLKO_005 5396 3UTR 100% 10.800 7.560 N OTUD5 n/a
6 TRCN0000233196 CCGACTACTTCTCCAACTATG pLKO_005 3977 CDS 100% 10.800 7.560 N OTUD5 n/a
7 TRCN0000145601 CACTAGCTTCTTTGGAATCTT pLKO.1 5701 3UTR 100% 5.625 3.938 N OTUD5 n/a
8 TRCN0000141437 CTGACCTTGCTGCATTCCTTT pLKO.1 5668 3UTR 100% 4.950 3.465 N OTUD5 n/a
9 TRCN0000122275 CCATCATTCAAACCAGGGTTT pLKO.1 4255 CDS 100% 4.050 2.835 N OTUD5 n/a
10 TRCN0000143838 CAACAGGAATACCTAGACAGT pLKO.1 4849 CDS 100% 2.640 1.848 N OTUD5 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1842 5UTR 100% 4.950 2.475 Y ERAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272622.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.