Transcript: Human XM_005273061.5

PREDICTED: Homo sapiens mitochondrial ribosomal protein L55 (MRPL55), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRPL55 (128308)
Length:
745
CDS:
284..670

Additional Resources:

NCBI RefSeq record:
XM_005273061.5
NBCI Gene record:
MRPL55 (128308)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273061.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236226 ATGCTGGCGATGCCCATAGAT pLKO_005 503 CDS 100% 5.625 7.875 N MRPL55 n/a
2 TRCN0000236223 CAGTCGAGGAAGGAGTACGAG pLKO_005 584 CDS 100% 0.880 1.232 N MRPL55 n/a
3 TRCN0000236227 CCAGGCTTATGCACGACTCTA pLKO_005 418 CDS 100% 4.950 3.465 N MRPL55 n/a
4 TRCN0000236225 TAGATCTGGACACCCTGTCTC pLKO_005 519 CDS 100% 4.050 2.835 N MRPL55 n/a
5 TRCN0000236224 AGTACGAGCAGGAGCTCAGTG pLKO_005 597 CDS 100% 1.350 0.945 N MRPL55 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273061.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04838 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04838 pLX_304 0% 100% 100% V5 n/a
Download CSV