Transcript: Human XM_005273990.5

PREDICTED: Homo sapiens pecanex 3 (PCNX3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCNX3 (399909)
Length:
4902
CDS:
1638..4841

Additional Resources:

NCBI RefSeq record:
XM_005273990.5
NBCI Gene record:
PCNX3 (399909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273990.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253848 ACTATCAAGACTGTCAATTAT pLKO_005 1854 CDS 100% 15.000 10.500 N PCNX3 n/a
2 TRCN0000253851 TGAGGGTGCTGTGCACTATTT pLKO_005 3611 CDS 100% 13.200 9.240 N PCNX3 n/a
3 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 255 5UTR 100% 1.080 0.540 Y GPR83 n/a
4 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 255 5UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273990.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.