Transcript: Human XM_005277541.2

PREDICTED: Homo sapiens diphosphoinositol pentakisphosphate kinase 2 (PPIP5K2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPIP5K2 (23262)
Length:
5499
CDS:
501..3920

Additional Resources:

NCBI RefSeq record:
XM_005277541.2
NBCI Gene record:
PPIP5K2 (23262)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005277541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136501 CGAGAACTTGCTCCACAATTT pLKO.1 1542 CDS 100% 13.200 10.560 N PPIP5K2 n/a
2 TRCN0000134115 CCATTCTTATCCCTAGTGTAT pLKO.1 4838 3UTR 100% 4.950 3.960 N PPIP5K2 n/a
3 TRCN0000376570 GAAACGAGCTATGGATTATTT pLKO_005 3095 CDS 100% 15.000 10.500 N PPIP5K2 n/a
4 TRCN0000134756 GCTACCTTAAAGAGCACTAAA pLKO.1 3771 CDS 100% 13.200 9.240 N PPIP5K2 n/a
5 TRCN0000376569 TCCACGGAAGACCGCTGAAAT pLKO_005 3659 CDS 100% 13.200 9.240 N PPIP5K2 n/a
6 TRCN0000133872 CCATTTCCATTCTTATCCCTA pLKO.1 4832 3UTR 100% 2.640 1.848 N PPIP5K2 n/a
7 TRCN0000217308 GGAAACGAGCTATGGATTATC pLKO.1 3094 CDS 100% 13.200 10.560 N Ppip5k2 n/a
8 TRCN0000191288 CCAATTCATATACACAGGAAA pLKO.1 3408 CDS 100% 4.950 3.465 N Ppip5k2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005277541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02743 pDONR223 100% 90.8% 90.8% None (many diffs) n/a
2 ccsbBroad304_02743 pLX_304 0% 90.8% 90.8% V5 (many diffs) n/a
Download CSV