Transcript: Mouse XM_006495499.3

PREDICTED: Mus musculus transcription factor AP-2, delta (Tfap2d), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tfap2d (226896)
Length:
4026
CDS:
326..1612

Additional Resources:

NCBI RefSeq record:
XM_006495499.3
NBCI Gene record:
Tfap2d (226896)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495499.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428732 ACACGTGTGAAACCGAGTTTC pLKO_005 1170 CDS 100% 10.800 15.120 N Tfap2d n/a
2 TRCN0000424257 ATACGTCACGACGGATCAAAC pLKO_005 293 5UTR 100% 10.800 15.120 N Tfap2d n/a
3 TRCN0000086524 CCTCAGTGAGATGCTTAACTA pLKO.1 1456 CDS 100% 5.625 7.875 N Tfap2d n/a
4 TRCN0000019709 CGGATCAAACAGCTACCGTTT pLKO.1 304 5UTR 100% 4.050 5.670 N TFAP2D n/a
5 TRCN0000086523 CTGCATCAAACAGAATCTATT pLKO.1 1613 CDS 100% 13.200 10.560 N Tfap2d n/a
6 TRCN0000086525 CCTCTCCTTTAACTTACTCTA pLKO.1 381 CDS 100% 4.950 3.960 N Tfap2d n/a
7 TRCN0000086526 CTTCTCAGTTCTACTTCCAAA pLKO.1 911 CDS 100% 4.950 3.465 N Tfap2d n/a
8 TRCN0000086527 GACTTTATTAACCTGCACAAT pLKO.1 587 CDS 100% 4.950 3.465 N Tfap2d n/a
9 TRCN0000019710 CGACTTTATTAACCTGCACAA pLKO.1 586 CDS 100% 4.050 2.835 N TFAP2D n/a
10 TRCN0000430442 AGTCCTTCCATTACGAGTTTC pLKO_005 468 CDS 100% 10.800 15.120 N TFAP2D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495499.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.