Transcript: Mouse XM_006495770.2

PREDICTED: Mus musculus Ngfi-A binding protein 1 (Nab1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nab1 (17936)
Length:
3580
CDS:
196..1656

Additional Resources:

NCBI RefSeq record:
XM_006495770.2
NBCI Gene record:
Nab1 (17936)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000345407 AGTAGCATACCCATCTATAAA pLKO_005 469 CDS 100% 15.000 21.000 N Nab1 n/a
2 TRCN0000305224 ATGTTACTCGTCAGCAATTAG pLKO_005 2061 3UTR 100% 13.200 18.480 N Nab1 n/a
3 TRCN0000096138 ACTCTGCATTCACCTTGGAAA pLKO.1 1598 CDS 100% 4.950 3.960 N Nab1 n/a
4 TRCN0000305280 TCGAGAAGTTACCTACAAGTA pLKO_005 1107 CDS 100% 4.950 3.960 N Nab1 n/a
5 TRCN0000345408 ATTGTAGGCATTCACTATTTA pLKO_005 1911 3UTR 100% 15.000 10.500 N Nab1 n/a
6 TRCN0000096136 GTGGTGAAAGAGATGAATTAT pLKO.1 1154 CDS 100% 15.000 10.500 N Nab1 n/a
7 TRCN0000351197 GTGGTGAAAGAGATGAATTAT pLKO_005 1154 CDS 100% 15.000 10.500 N Nab1 n/a
8 TRCN0000345406 AGAGAGCCTTGGGATTCTAAA pLKO_005 1566 CDS 100% 13.200 9.240 N Nab1 n/a
9 TRCN0000096134 CCATCATAGATTAAGCCTTAA pLKO.1 1710 3UTR 100% 10.800 7.560 N Nab1 n/a
10 TRCN0000345474 GAAAGTACAGCGCCATCTATG pLKO_005 941 CDS 100% 10.800 7.560 N Nab1 n/a
11 TRCN0000305282 GTGACGAAGACCCACACAAAG pLKO_005 908 CDS 100% 10.800 7.560 N Nab1 n/a
12 TRCN0000305281 TGAGAGACTGGGTTACAAATC pLKO_005 410 CDS 100% 10.800 7.560 N Nab1 n/a
13 TRCN0000096135 GCAATAGTTATGAAAGGAGTA pLKO.1 527 CDS 100% 4.050 2.835 N Nab1 n/a
14 TRCN0000096137 GCTTTCTTACTTTGATGCCTT pLKO.1 264 CDS 100% 2.640 1.848 N Nab1 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3227 3UTR 100% 4.950 2.475 Y KAAG1 n/a
16 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 3231 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495770.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.