Transcript: Mouse XM_006495969.3

PREDICTED: Mus musculus a disintegrin and metallopeptidase domain 23 (Adam23), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adam23 (23792)
Length:
6267
CDS:
330..2819

Additional Resources:

NCBI RefSeq record:
XM_006495969.3
NBCI Gene record:
Adam23 (23792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495969.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305063 ATGGCGGTGGCACAAGTATTA pLKO_005 1587 CDS 100% 13.200 18.480 N Adam23 n/a
2 TRCN0000305124 GGGTTAAAGACCATGTCATTA pLKO_005 3039 3UTR 100% 13.200 18.480 N Adam23 n/a
3 TRCN0000305062 TAATGATCACAAGACGTATAA pLKO_005 1238 CDS 100% 13.200 18.480 N Adam23 n/a
4 TRCN0000032660 CCACGGAATGTGGAAATGGAT pLKO.1 1825 CDS 100% 3.000 4.200 N Adam23 n/a
5 TRCN0000305123 AGGCGTGTGTTCTCGAATAAG pLKO_005 1535 CDS 100% 13.200 10.560 N Adam23 n/a
6 TRCN0000032662 CCGACTTCCTTCTATCATCAA pLKO.1 2358 CDS 100% 4.950 3.960 N Adam23 n/a
7 TRCN0000308471 CCGACTTCCTTCTATCATCAA pLKO_005 2358 CDS 100% 4.950 3.960 N Adam23 n/a
8 TRCN0000032659 CGACCACACATAATCCAGAAA pLKO.1 1053 CDS 100% 4.950 3.960 N Adam23 n/a
9 TRCN0000032663 CCCTCCATGATGTGCTTAGAT pLKO.1 2466 CDS 100% 5.625 3.938 N Adam23 n/a
10 TRCN0000032661 CCTATCATGTTCTTGACACAA pLKO.1 703 CDS 100% 4.950 3.465 N Adam23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495969.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.