Transcript: Mouse XM_006495974.2

PREDICTED: Mus musculus calcium response factor (Carf), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Carf (241066)
Length:
5636
CDS:
406..2370

Additional Resources:

NCBI RefSeq record:
XM_006495974.2
NBCI Gene record:
Carf (241066)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086261 CCAGCCAGGATATACATTAAA pLKO.1 1168 CDS 100% 15.000 21.000 N Carf n/a
2 TRCN0000415127 GCTTCAGTGGACGACAGATAG pLKO_005 1716 CDS 100% 10.800 15.120 N Carf n/a
3 TRCN0000086259 GCGCATAAGATTCAGGAACTA pLKO.1 1486 CDS 100% 4.950 6.930 N Carf n/a
4 TRCN0000086258 GCTCCAATATTTGTTGCCAAT pLKO.1 2494 3UTR 100% 4.050 5.670 N Carf n/a
5 TRCN0000425483 AGATACCTGAAAGACATAATT pLKO_005 1589 CDS 100% 15.000 10.500 N Carf n/a
6 TRCN0000424876 CTGTCTAAGAACCAAGTTAAA pLKO_005 2275 CDS 100% 13.200 9.240 N Carf n/a
7 TRCN0000086262 GACGATGGTGAGAAGTCAGAA pLKO.1 439 CDS 100% 4.950 3.465 N Carf n/a
8 TRCN0000086260 GCAGATGAACATAGCCCTCAA pLKO.1 643 CDS 100% 4.050 2.835 N Carf n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3476 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3476 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3476 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3478 3UTR 100% 4.950 2.475 Y CFLAR n/a
13 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3478 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.