Transcript: Mouse XM_006496150.3

PREDICTED: Mus musculus transmembrane protein 131 (Tmem131), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tmem131 (56030)
Length:
6627
CDS:
270..5900

Additional Resources:

NCBI RefSeq record:
XM_006496150.3
NBCI Gene record:
Tmem131 (56030)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246000 ATTATGCGCCAAGATCTAATT pLKO_005 6297 3UTR 100% 13.200 18.480 N TMEM131 n/a
2 TRCN0000217267 CAGTCAAGAACTAGGTAATAC pLKO.1 4889 CDS 100% 13.200 18.480 N Tmem131 n/a
3 TRCN0000216020 CGATTCTACTACAAACGATTA pLKO.1 2409 CDS 100% 10.800 15.120 N Tmem131 n/a
4 TRCN0000435474 GTGGATCCAAATCACGAAATC pLKO_005 4798 CDS 100% 10.800 15.120 N Tmem131 n/a
5 TRCN0000193221 CCTCAACTGAAATGTTAGATT pLKO.1 1234 CDS 100% 5.625 7.875 N Tmem131 n/a
6 TRCN0000194384 CAGAAATGTAAGCCAGCGTAA pLKO.1 6398 3UTR 100% 4.050 5.670 N Tmem131 n/a
7 TRCN0000430052 ATTCAGTCGGAGAGCATAATA pLKO_005 456 CDS 100% 15.000 12.000 N Tmem131 n/a
8 TRCN0000420766 CCGTCTTTGCAGATAAGTTAG pLKO_005 2887 CDS 100% 10.800 8.640 N Tmem131 n/a
9 TRCN0000422242 AGAAGTTCTAGATGGTTATTT pLKO_005 1541 CDS 100% 15.000 10.500 N Tmem131 n/a
10 TRCN0000436995 CACAGCCTTCATCCGGATAAA pLKO_005 1136 CDS 100% 13.200 9.240 N Tmem131 n/a
11 TRCN0000217090 CAGGAGAATCGTTGGTATTTC pLKO.1 3776 CDS 100% 13.200 9.240 N Tmem131 n/a
12 TRCN0000423700 GCAGTCAAGAACTAGGTAATA pLKO_005 4888 CDS 100% 13.200 9.240 N Tmem131 n/a
13 TRCN0000175528 CATTACAGTTAAGGGAGTGAT pLKO.1 6201 3UTR 100% 4.950 3.465 N Tmem131 n/a
14 TRCN0000173139 CCAGAGAAGTTGGAATGAGTT pLKO.1 5501 CDS 100% 4.950 3.465 N Tmem131 n/a
15 TRCN0000173637 CCTCGGTTCATATCAACAGAA pLKO.1 530 CDS 100% 4.950 3.465 N Tmem131 n/a
16 TRCN0000175781 GCTGTTGTGCTTAAAGACAAA pLKO.1 6071 3UTR 100% 4.950 3.465 N Tmem131 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.