Transcript: Mouse XM_006496703.3

PREDICTED: Mus musculus paired related homeobox 1 (Prrx1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prrx1 (18933)
Length:
4752
CDS:
1071..1724

Additional Resources:

NCBI RefSeq record:
XM_006496703.3
NBCI Gene record:
Prrx1 (18933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349761 GCTCCCAGACCAACCGATTAT pLKO_005 1620 CDS 100% 13.200 18.480 N Prrx1 n/a
2 TRCN0000070708 GCGGAGAAACAGGACAACATT pLKO.1 1352 CDS 100% 5.625 7.875 N Prrx1 n/a
3 TRCN0000436440 ATAACGGATTCTAACGGAAGA pLKO_005 1711 CDS 100% 4.050 5.670 N PRRX1 n/a
4 TRCN0000070712 GCTGTGGAGCAACCCATCGTA pLKO.1 1590 CDS 100% 1.000 1.400 N Prrx1 n/a
5 TRCN0000349402 GCTGTGGAGCAACCCATCGTA pLKO_005 1590 CDS 100% 1.000 1.400 N Prrx1 n/a
6 TRCN0000070711 CGAGCCATGCTGGCCAATAAA pLKO.1 1530 CDS 100% 15.000 10.500 N Prrx1 n/a
7 TRCN0000311852 CGAGCCATGCTGGCCAATAAA pLKO_005 1530 CDS 100% 15.000 10.500 N Prrx1 n/a
8 TRCN0000220233 GTCCCTCCCAAGATGTTGTTT pLKO.1 1676 CDS 100% 5.625 3.938 N PRRX1 n/a
9 TRCN0000070709 GCAGGACAATGACCAGTTGAA pLKO.1 1304 CDS 100% 4.950 3.465 N Prrx1 n/a
10 TRCN0000070710 CGTGTCTTTGAGCGGACACAT pLKO.1 1401 CDS 100% 0.495 0.347 N Prrx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.