Transcript: Mouse XM_006496834.4

PREDICTED: Mus musculus regulator of G protein signaling 7 (Rgs7), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Rgs7 (24012)
Length:
2702
CDS:
649..1977

Additional Resources:

NCBI RefSeq record:
XM_006496834.4
NBCI Gene record:
Rgs7 (24012)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496834.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037090 GCACGTATGCAAGACGAGAAA pLKO.1 742 CDS 100% 4.950 6.930 N Rgs7 n/a
2 TRCN0000037093 GCTGATAGTCTACTAAGCTAT pLKO.1 1327 CDS 100% 4.950 6.930 N Rgs7 n/a
3 TRCN0000037092 CCAGGACGATACACATTTGAA pLKO.1 1729 CDS 100% 5.625 3.938 N Rgs7 n/a
4 TRCN0000037089 CCAGTGCCATTAACTTGGATT pLKO.1 1670 CDS 100% 4.950 3.465 N Rgs7 n/a
5 TRCN0000037091 CGGATGAGAAACCCACACAAA pLKO.1 1144 CDS 100% 4.950 3.465 N Rgs7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496834.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06863 pDONR223 100% 77.2% 83.3% None (many diffs) n/a
2 ccsbBroad304_06863 pLX_304 0% 77.2% 83.3% V5 (many diffs) n/a
Download CSV