Transcript: Mouse XM_006496913.3

PREDICTED: Mus musculus mechanosensory transduction mediator (Stum), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stum (381310)
Length:
5894
CDS:
191..607

Additional Resources:

NCBI RefSeq record:
XM_006496913.3
NBCI Gene record:
Stum (381310)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496913.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267805 GGTACATTCGTCTCGGCATTC pLKO_005 392 CDS 100% 6.000 8.400 N Stum n/a
2 TRCN0000376188 CAACACTTTCGTGCCGGGATT pLKO_005 370 CDS 100% 4.050 5.670 N Stum n/a
3 TRCN0000376252 GCACAAGGACCTTCATATATT pLKO_005 668 3UTR 100% 15.000 10.500 N Stum n/a
4 TRCN0000267804 CTGCGTCTTCTGGCTGAATAT pLKO_005 460 CDS 100% 13.200 9.240 N Stum n/a
5 TRCN0000346187 GGGTAGAAAGGGAGTACTTAC pLKO_005 712 3UTR 100% 10.800 7.560 N Stum n/a
6 TRCN0000165468 GCTGGATCATGAGCATCTTCT pLKO.1 525 CDS 100% 4.950 3.465 N STUM n/a
7 TRCN0000376189 CACAACAGCTGTGAGCCTACA pLKO_005 594 CDS 100% 4.050 2.835 N Stum n/a
8 TRCN0000376253 GGCATGGACATGGTCATCCTT pLKO_005 548 CDS 100% 3.000 2.100 N Stum n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496913.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.