Transcript: Mouse XM_006497071.3

PREDICTED: Mus musculus lamin B receptor (Lbr), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lbr (98386)
Length:
3634
CDS:
211..2091

Additional Resources:

NCBI RefSeq record:
XM_006497071.3
NBCI Gene record:
Lbr (98386)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497071.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359441 TGATTGGATGGGTGGTTATTA pLKO_005 1421 CDS 100% 15.000 10.500 N LBR n/a
2 TRCN0000054904 CCTGCCATACTTCTACATTAT pLKO.1 1944 CDS 100% 13.200 9.240 N Lbr n/a
3 TRCN0000309611 CCTGCCATACTTCTACATTAT pLKO_005 1944 CDS 100% 13.200 9.240 N Lbr n/a
4 TRCN0000054905 GCTTTCGATCTCAAGTTCTTT pLKO.1 1381 CDS 100% 5.625 3.938 N Lbr n/a
5 TRCN0000309672 GCTTTCGATCTCAAGTTCTTT pLKO_005 1381 CDS 100% 5.625 3.938 N Lbr n/a
6 TRCN0000054903 GCTGAAGAATAAGGGCAGATT pLKO.1 2489 3UTR 100% 4.950 3.465 N Lbr n/a
7 TRCN0000309676 GCTGAAGAATAAGGGCAGATT pLKO_005 2489 3UTR 100% 4.950 3.465 N Lbr n/a
8 TRCN0000054907 CGACAACAAATCCCAGCTCTA pLKO.1 300 CDS 100% 4.050 2.835 N Lbr n/a
9 TRCN0000054906 GCTTGCACATTTGAAGACCAT pLKO.1 1800 CDS 100% 2.640 1.848 N Lbr n/a
10 TRCN0000309674 GCTTGCACATTTGAAGACCAT pLKO_005 1800 CDS 100% 2.640 1.848 N Lbr n/a
11 TRCN0000140823 GAAGGAGAAGAAGGAGAAGGT pLKO.1 540 CDS 100% 2.640 1.320 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497071.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.