Transcript: Mouse XM_006497199.3

PREDICTED: Mus musculus G patch domain containing 2 (Gpatch2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpatch2 (67769)
Length:
1450
CDS:
134..1435

Additional Resources:

NCBI RefSeq record:
XM_006497199.3
NBCI Gene record:
Gpatch2 (67769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497199.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216477 GAACGCCTTCAAAGAATATTA pLKO.1 1179 CDS 100% 15.000 21.000 N Gpatch2 n/a
2 TRCN0000258031 GAACGCCTTCAAAGAATATTA pLKO_005 1179 CDS 100% 15.000 21.000 N Gpatch2 n/a
3 TRCN0000217726 GCATCAGCTTCTGAGAGATAA pLKO.1 1336 CDS 100% 13.200 18.480 N Gpatch2 n/a
4 TRCN0000184250 GCTGGCATTTCAGTCGAACAA pLKO.1 183 CDS 100% 4.950 6.930 N Gpatch2 n/a
5 TRCN0000250349 ACTGGAGAACATTCTCGAAAT pLKO_005 278 CDS 100% 10.800 7.560 N Gpatch2 n/a
6 TRCN0000250348 ATCGCCATGACCACTGGTTTA pLKO_005 1287 CDS 100% 10.800 7.560 N Gpatch2 n/a
7 TRCN0000416209 CTTAAGTGAAGGCTCTGATTC pLKO_005 391 CDS 100% 10.800 7.560 N GPATCH2 n/a
8 TRCN0000250347 GGAAGCGGAGATCCTACAATG pLKO_005 342 CDS 100% 10.800 7.560 N Gpatch2 n/a
9 TRCN0000179472 GCTTAAGTGAAGGCTCTGATT pLKO.1 390 CDS 100% 4.950 3.465 N Gpatch2 n/a
10 TRCN0000134147 CATCAGCTTCTGAGAGATAAT pLKO.1 1337 CDS 100% 13.200 9.240 N GPATCH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497199.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.