Transcript: Mouse XM_006497206.3

PREDICTED: Mus musculus retinal degeneration 3 (Rd3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rd3 (74023)
Length:
3941
CDS:
2465..3052

Additional Resources:

NCBI RefSeq record:
XM_006497206.3
NBCI Gene record:
Rd3 (74023)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247163 CCAGTGACATCCGAACCATCT pLKO_005 2952 CDS 100% 4.050 5.670 N Rd3 n/a
2 TRCN0000257733 CCCACATACTCATCCCAATTT pLKO_005 3280 3UTR 100% 13.200 9.240 N Rd3 n/a
3 TRCN0000247164 GACTACAGCTGGTTGGCAAAC pLKO_005 2639 CDS 100% 6.000 4.200 N Rd3 n/a
4 TRCN0000247166 AGATCCACCCATCCTACTGTG pLKO_005 2724 CDS 100% 4.050 2.835 N Rd3 n/a
5 TRCN0000247165 CCATAAGCTGACACGTCAGTG pLKO_005 2869 CDS 100% 4.050 2.835 N Rd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05488 pDONR223 100% 83% 85.6% None (many diffs) n/a
2 ccsbBroad304_05488 pLX_304 0% 83% 85.6% V5 (many diffs) n/a
3 TRCN0000468516 TCTTGTAGACCGCTTTCAGGGATG pLX_317 62.6% 83% 85.6% V5 (many diffs) n/a
Download CSV