Transcript: Mouse XM_006497262.3

PREDICTED: Mus musculus interferon regulatory factor 6 (Irf6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Irf6 (54139)
Length:
4224
CDS:
295..1698

Additional Resources:

NCBI RefSeq record:
XM_006497262.3
NBCI Gene record:
Irf6 (54139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497262.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321531 GTCAGCGGACATGCCATTTAT pLKO_005 1210 CDS 100% 15.000 21.000 N Irf6 n/a
2 TRCN0000321533 ACGATCCTGACCCAGCTAAAT pLKO_005 509 CDS 100% 13.200 18.480 N Irf6 n/a
3 TRCN0000321594 GACGTTAGACAGATCGTTTAA pLKO_005 1975 3UTR 100% 13.200 18.480 N Irf6 n/a
4 TRCN0000085331 GCAAACTATGACGGTGAGCAA pLKO.1 1008 CDS 100% 2.640 3.696 N Irf6 n/a
5 TRCN0000360595 GAGATTTGATGTCGAAGTTTA pLKO_005 1918 3UTR 100% 13.200 10.560 N Irf6 n/a
6 TRCN0000085329 CGCATGATCTATGAGATGTTT pLKO.1 1492 CDS 100% 5.625 4.500 N Irf6 n/a
7 TRCN0000085332 CGTGGGAAGGAGTATGGGCAA pLKO.1 991 CDS 100% 0.720 0.576 N Irf6 n/a
8 TRCN0000360666 ACCCAGGGCTCTGTCATTAAT pLKO_005 649 CDS 100% 15.000 10.500 N Irf6 n/a
9 TRCN0000085330 CCTTGGGATGAGAAAGATAAT pLKO.1 691 CDS 100% 13.200 9.240 N Irf6 n/a
10 TRCN0000360665 CTTGGGATGAGAAAGATAATG pLKO_005 692 CDS 100% 13.200 9.240 N Irf6 n/a
11 TRCN0000321534 GACTGACTTGGACATCAAATT pLKO_005 963 CDS 100% 13.200 9.240 N Irf6 n/a
12 TRCN0000321532 TGAATCCTGTGAAGATCTATC pLKO_005 608 CDS 100% 10.800 7.560 N Irf6 n/a
13 TRCN0000085328 CCGTTCTTGTTCAGAGACTTT pLKO.1 2634 3UTR 100% 4.950 3.465 N Irf6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497262.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.