Transcript: Mouse XM_006497432.3

PREDICTED: Mus musculus threonine synthase-like 1 (bacterial) (Thnsl1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Thnsl1 (208967)
Length:
3864
CDS:
614..2857

Additional Resources:

NCBI RefSeq record:
XM_006497432.3
NBCI Gene record:
Thnsl1 (208967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423180 ACTACTTCCGCAGATAGTTTA pLKO_005 2038 CDS 100% 13.200 18.480 N Thnsl1 n/a
2 TRCN0000075911 GCACGTAAGACTGTACTATAA pLKO.1 1174 CDS 100% 13.200 18.480 N Thnsl1 n/a
3 TRCN0000075910 CGTAAGACTGTACTATAAGAA pLKO.1 1177 CDS 100% 5.625 7.875 N Thnsl1 n/a
4 TRCN0000075909 GCCTCTAATCAGAACCACGTT pLKO.1 2210 CDS 100% 2.640 3.696 N Thnsl1 n/a
5 TRCN0000075908 GCTAACAAAGACGGACAGTTA pLKO.1 2351 CDS 100% 4.950 3.960 N Thnsl1 n/a
6 TRCN0000427805 ACAATGCATCAGGCTATATTT pLKO_005 2508 CDS 100% 15.000 10.500 N Thnsl1 n/a
7 TRCN0000230782 TACAGCTTATGCCTCATATTT pLKO_005 1677 CDS 100% 15.000 10.500 N THNSL1 n/a
8 TRCN0000420517 GTGCTGCATATCTAGTCATTT pLKO_005 3124 3UTR 100% 13.200 9.240 N Thnsl1 n/a
9 TRCN0000429573 TGGAATATGGAACAATCTTAA pLKO_005 1989 CDS 100% 13.200 9.240 N Thnsl1 n/a
10 TRCN0000075912 GACGGACAGTTAATGGCAAAT pLKO.1 2360 CDS 100% 10.800 7.560 N Thnsl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.