Transcript: Mouse XM_006497460.1

PREDICTED: Mus musculus DNA cross-link repair 1C (Dclre1c), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dclre1c (227525)
Length:
3678
CDS:
451..2130

Additional Resources:

NCBI RefSeq record:
XM_006497460.1
NBCI Gene record:
Dclre1c (227525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175129 CCTTTCGATGTTGCAATACAA pLKO.1 2230 3UTR 100% 5.625 7.875 N Dclre1c n/a
2 TRCN0000175024 GCTAACTTCATAGACTGTGAA pLKO.1 1345 CDS 100% 4.950 3.960 N Dclre1c n/a
3 TRCN0000193680 CAAAGTACAAACCGCTTGGAA pLKO.1 1112 CDS 100% 3.000 2.400 N Dclre1c n/a
4 TRCN0000194066 GCCTCTCAAATAGAACAGGAT pLKO.1 1822 CDS 100% 2.640 2.112 N Dclre1c n/a
5 TRCN0000193442 GCTTATGGCTACGAGTATTTA pLKO.1 637 CDS 100% 15.000 10.500 N Dclre1c n/a
6 TRCN0000175933 GAGTATCCAACCATCTCCATT pLKO.1 81 5UTR 100% 4.950 3.465 N Dclre1c n/a
7 TRCN0000173672 CCCTGTGGTATAACTTCCCAA pLKO.1 823 CDS 100% 2.640 1.848 N Dclre1c n/a
8 TRCN0000193184 CAACAACAACAACAACAGAAA pLKO.1 2176 3UTR 100% 4.950 2.475 Y Dclre1c n/a
9 TRCN0000174943 GCACACATACATACATACATA pLKO.1 3371 3UTR 100% 5.625 2.813 Y Lrrn4cl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.